Transcript: Human XM_005273682.1

PREDICTED: Homo sapiens ASH2 like, histone lysine methyltransferase complex subunit (ASH2L), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ASH2L (9070)
Length:
3123
CDS:
587..2491

Additional Resources:

NCBI RefSeq record:
XM_005273682.1
NBCI Gene record:
ASH2L (9070)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005273682.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019274 GTGACTTGTTATCCTACTATA pLKO.1 2777 3UTR 100% 13.200 18.480 N ASH2L n/a
2 TRCN0000342802 GTGACTTGTTATCCTACTATA pLKO_005 2777 3UTR 100% 13.200 18.480 N ASH2L n/a
3 TRCN0000019276 CCTGCTTGTATGAACGGGTTT pLKO.1 1728 CDS 100% 4.050 5.670 N ASH2L n/a
4 TRCN0000342801 CCTGCTTGTATGAACGGGTTT pLKO_005 1728 CDS 100% 4.050 5.670 N ASH2L n/a
5 TRCN0000019277 CCCGTTTAACAAAGATGGCTA pLKO.1 1606 CDS 100% 2.640 3.696 N ASH2L n/a
6 TRCN0000342870 CCCATTGGAACACCCGTTTAA pLKO_005 1594 CDS 100% 13.200 9.240 N ASH2L n/a
7 TRCN0000342871 TTGGAGACAGAATCATCTAAT pLKO_005 806 CDS 100% 13.200 9.240 N ASH2L n/a
8 TRCN0000380150 GGCAAACTTGGTCGATGTAAG pLKO_005 778 CDS 100% 10.800 7.560 N ASH2L n/a
9 TRCN0000019278 GCTGACACATTTGGCATAGAT pLKO.1 962 CDS 100% 5.625 3.938 N ASH2L n/a
10 TRCN0000019275 CCGAAGACAATGTTCTCCAAA pLKO.1 1145 CDS 100% 4.950 3.465 N ASH2L n/a
11 TRCN0000342868 CCGAAGACAATGTTCTCCAAA pLKO_005 1145 CDS 100% 4.950 3.465 N ASH2L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005273682.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07354 pDONR223 100% 84.1% 84.2% None 1_282del;853_870del;1272A>G n/a
2 ccsbBroad304_07354 pLX_304 0% 84.1% 84.2% V5 1_282del;853_870del;1272A>G n/a
3 TRCN0000466657 TTACACCCTGAGGTTTATGTGTAT pLX_317 26% 84.1% 84.2% V5 1_282del;853_870del;1272A>G n/a
Download CSV