Transcript: Human XM_005274434.3

PREDICTED: Homo sapiens acetylserotonin O-methyltransferase like (ASMTL), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ASMTL (8623)
Length:
2239
CDS:
244..2109

Additional Resources:

NCBI RefSeq record:
XM_005274434.3
NBCI Gene record:
ASMTL (8623)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005274434.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000343886 ACAGAGCAAGGTTACAGTAAC pLKO_005 1294 CDS 100% 10.800 15.120 N ASMTL n/a
2 TRCN0000343885 TGGCATCGGATGGCGAATACT pLKO_005 1337 CDS 100% 5.625 7.875 N ASMTL n/a
3 TRCN0000034537 CGTATGCAGGTGACTGTGTTT pLKO.1 1666 CDS 100% 4.950 6.930 N ASMTL n/a
4 TRCN0000343953 CAAACTGAAGGTGTTCGATTT pLKO_005 1158 CDS 100% 10.800 8.640 N ASMTL n/a
5 TRCN0000034535 GCAAACTGAAGGTGTTCGATT pLKO.1 1157 CDS 100% 4.950 3.960 N ASMTL n/a
6 TRCN0000034534 CCTCTTTACATACCTGGAGTT pLKO.1 1401 CDS 100% 4.050 3.240 N ASMTL n/a
7 TRCN0000343955 ACCTCACATGGAACCTCTTTA pLKO_005 1388 CDS 100% 13.200 9.240 N ASMTL n/a
8 TRCN0000370453 CTGTTCCAGGATGCGTACTAC pLKO_005 1480 CDS 100% 4.950 3.465 N ASMTL n/a
9 TRCN0000370512 CCTTCAATCTGTCCCGCTTCT pLKO_005 1580 CDS 100% 4.050 2.835 N ASMTL n/a
10 TRCN0000034536 CTACGAGGAAACGAAGGTGAA pLKO.1 675 CDS 100% 4.050 2.835 N ASMTL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005274434.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07274 pDONR223 100% 99.7% 99.8% None (many diffs) n/a
2 ccsbBroad304_07274 pLX_304 0% 99.7% 99.8% V5 (many diffs) n/a
3 ccsbBroadEn_07273 pDONR223 100% 99.6% 99.8% None (many diffs) n/a
4 ccsbBroad304_07273 pLX_304 0% 99.6% 99.8% V5 (many diffs) n/a
5 TRCN0000471070 CTCGTCCCCAAGACGGGTGCAAAT pLX_317 24% 99.6% 99.8% V5 (many diffs) n/a
Download CSV