Transcript: Mouse XM_006495441.3

PREDICTED: Mus musculus phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2 (Prex2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prex2 (109294)
Length:
11305
CDS:
522..5375

Additional Resources:

NCBI RefSeq record:
XM_006495441.3
NBCI Gene record:
Prex2 (109294)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006495441.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081349 CCGGCTGATCACCTCATTTAT pLKO.1 5003 CDS 100% 15.000 21.000 N Prex2 n/a
2 TRCN0000069654 CCACCGAATACCACATCTAAA pLKO.1 4929 CDS 100% 13.200 10.560 N LOC240711 n/a
3 TRCN0000081351 CTAGAGCAAACCATCACTTTA pLKO.1 5178 CDS 100% 13.200 9.240 N Prex2 n/a
4 TRCN0000081350 CACCTCCAGTAGGAGAAGAAT pLKO.1 5353 CDS 100% 5.625 3.938 N Prex2 n/a
5 TRCN0000069653 GCTGCCTTAAACCAGATGTTT pLKO.1 4404 CDS 100% 5.625 3.938 N LOC240711 n/a
6 TRCN0000081352 ACCTCATTTATCAGATCCAAA pLKO.1 5013 CDS 100% 4.950 3.465 N Prex2 n/a
7 TRCN0000081348 CCGAAGACAAAGAGATGCAAA pLKO.1 5434 3UTR 100% 4.950 3.465 N Prex2 n/a
8 TRCN0000069656 GCCTTTGAGCAGACCAAGTAT pLKO.1 4104 CDS 100% 5.625 3.375 N LOC240711 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7334 3UTR 100% 4.950 2.475 Y KAAG1 n/a
10 TRCN0000162548 CACACACACACACACAAATAT pLKO.1 7338 3UTR 100% 15.000 7.500 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006495441.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.