Transcript: Mouse XM_006495713.2

PREDICTED: Mus musculus interleukin 1 receptor, type I (Il1r1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Il1r1 (16177)
Length:
4758
CDS:
220..1950

Additional Resources:

NCBI RefSeq record:
XM_006495713.2
NBCI Gene record:
Il1r1 (16177)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006495713.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012342 CGTGAGCTTCTTCGGAGTAAA pLKO.1 741 CDS 100% 13.200 18.480 N Il1r1 n/a
2 TRCN0000012340 CGACACCATAATTTGGTACAA pLKO.1 384 CDS 100% 4.950 6.930 N Il1r1 n/a
3 TRCN0000344988 CGACACCATAATTTGGTACAA pLKO_005 384 CDS 100% 4.950 6.930 N Il1r1 n/a
4 TRCN0000012341 CCATTGTCTAAACACCGCTTA pLKO.1 1861 CDS 100% 4.050 5.670 N Il1r1 n/a
5 TRCN0000345063 CCATTGTCTAAACACCGCTTA pLKO_005 1861 CDS 100% 4.050 5.670 N Il1r1 n/a
6 TRCN0000012338 CCGTACTTTCTGATGGTGTTT pLKO.1 4392 3UTR 100% 4.950 3.960 N Il1r1 n/a
7 TRCN0000345064 CCGTACTTTCTGATGGTGTTT pLKO_005 4392 3UTR 100% 4.950 3.960 N Il1r1 n/a
8 TRCN0000012339 CCAGATTCTATTCAGTTCATT pLKO.1 1726 CDS 100% 5.625 3.938 N Il1r1 n/a
9 TRCN0000344990 CCAGATTCTATTCAGTTCATT pLKO_005 1726 CDS 100% 5.625 3.938 N Il1r1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006495713.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.