Transcript: Mouse XM_006495814.2

PREDICTED: Mus musculus signal transducer and activator of transcription 4 (Stat4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stat4 (20849)
Length:
2695
CDS:
7..2442

Additional Resources:

NCBI RefSeq record:
XM_006495814.2
NBCI Gene record:
Stat4 (20849)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006495814.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235842 ACGGTGCAAACGGACACTTTA pLKO_005 2442 CDS 100% 13.200 18.480 N Stat4 n/a
2 TRCN0000081640 GCGAGACTACAAGGTTATCAT pLKO.1 2121 CDS 100% 5.625 7.875 N Stat4 n/a
3 TRCN0000081642 CGCTGCAAGAAATGCTTAATA pLKO.1 785 CDS 100% 15.000 12.000 N Stat4 n/a
4 TRCN0000081641 CGTCCATTGACAAGAATGTTT pLKO.1 1277 CDS 100% 5.625 4.500 N Stat4 n/a
5 TRCN0000081639 GCGTCCATTGACAAGAATGTT pLKO.1 1276 CDS 100% 5.625 4.500 N Stat4 n/a
6 TRCN0000235844 AGCAATATTGGACCTAATTAA pLKO_005 1860 CDS 100% 15.000 10.500 N Stat4 n/a
7 TRCN0000235841 CTACAGGAGCAATCTACTAAA pLKO_005 1030 CDS 100% 13.200 9.240 N Stat4 n/a
8 TRCN0000235840 CTTTACCATAGATCACAATTT pLKO_005 2494 3UTR 100% 13.200 9.240 N Stat4 n/a
9 TRCN0000235843 GCTATTGATTCACAATCTAAA pLKO_005 426 CDS 100% 13.200 9.240 N Stat4 n/a
10 TRCN0000081638 CGGCTTTGTAAATACCAGTTT pLKO.1 2522 3UTR 100% 4.950 3.465 N Stat4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006495814.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01610 pDONR223 100% 81.5% 87.4% None (many diffs) n/a
2 ccsbBroad304_01610 pLX_304 0% 81.5% 87.4% V5 (many diffs) n/a
3 TRCN0000473864 AGATCCTCAGTTGCCCGGATGGTT pLX_317 19.2% 81.5% 87.4% V5 (many diffs) n/a
Download CSV