Transcript: Mouse XM_006495957.3

PREDICTED: Mus musculus angio-associated migratory protein (Aamp), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Aamp (227290)
Length:
1879
CDS:
197..1489

Additional Resources:

NCBI RefSeq record:
XM_006495957.3
NBCI Gene record:
Aamp (227290)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006495957.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179278 GAATGGTGACTGTAAGACCTT pLKO.1 796 CDS 100% 2.640 3.696 N Aamp n/a
2 TRCN0000314383 GAATGGTGACTGTAAGACCTT pLKO_005 796 CDS 100% 2.640 3.696 N Aamp n/a
3 TRCN0000182912 CGTGTCTCTTTGACTTTGATT pLKO.1 1709 3UTR 100% 5.625 3.938 N Aamp n/a
4 TRCN0000314385 CGTGTCTCTTTGACTTTGATT pLKO_005 1709 3UTR 100% 5.625 3.938 N Aamp n/a
5 TRCN0000184163 CAGGTAGACACCAAGGAAGAA pLKO.1 668 CDS 100% 4.950 3.465 N Aamp n/a
6 TRCN0000184306 GCCACAAAGACTCTGTGACAT pLKO.1 579 CDS 100% 4.950 3.465 N Aamp n/a
7 TRCN0000183886 CATCAGGAGACCACAAAGCAA pLKO.1 1437 CDS 100% 3.000 2.100 N Aamp n/a
8 TRCN0000314445 CATCAGGAGACCACAAAGCAA pLKO_005 1437 CDS 100% 3.000 2.100 N Aamp n/a
9 TRCN0000184142 CCTGCTTACTCCTTGTCCTTT pLKO.1 1621 3UTR 100% 4.950 2.970 N Aamp n/a
10 TRCN0000314384 CCTGCTTACTCCTTGTCCTTT pLKO_005 1621 3UTR 100% 4.950 2.970 N Aamp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006495957.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10668 pDONR223 100% 81.7% 88.8% None (many diffs) n/a
2 ccsbBroad304_10668 pLX_304 0% 81.7% 88.8% V5 (many diffs) n/a
Download CSV