Transcript: Mouse XM_006496030.3

PREDICTED: Mus musculus neurobeachin like 1 (Nbeal1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nbeal1 (269198)
Length:
16118
CDS:
629..8782

Additional Resources:

NCBI RefSeq record:
XM_006496030.3
NBCI Gene record:
Nbeal1 (269198)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496030.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375468 GGTTGTATTAAGTCCATATTT pLKO_005 9024 3UTR 100% 15.000 21.000 N Nbeal1 n/a
2 TRCN0000249524 ACCCGGATGATTACGAGTTAT pLKO_005 9737 3UTR 100% 13.200 18.480 N Nbeal1 n/a
3 TRCN0000143702 GATGATATGCCTCCAGGAATA pLKO.1 776 CDS 100% 10.800 8.640 N NBEAL1 n/a
4 TRCN0000249521 ATGGCAGGACGAACCTATAAT pLKO_005 6767 CDS 100% 15.000 10.500 N Nbeal1 n/a
5 TRCN0000282182 ATGGCAGGACGAACCTATAAT pLKO_005 6767 CDS 100% 15.000 10.500 N NBEAL1 n/a
6 TRCN0000249522 CAAGATGAAGCATGCTATATT pLKO_005 5522 CDS 100% 15.000 10.500 N Nbeal1 n/a
7 TRCN0000249523 CAGAGTATCATAGGTTATATA pLKO_005 3989 CDS 100% 15.000 10.500 N Nbeal1 n/a
8 TRCN0000249525 GTGATGGTATTCCACTATTAA pLKO_005 7656 CDS 100% 15.000 10.500 N Nbeal1 n/a
9 TRCN0000262294 AGATCACCACAGGAGTTATTC pLKO_005 6671 CDS 100% 13.200 9.240 N NBEAL1 n/a
10 TRCN0000375469 CACATAGCATGGCCGGAATTT pLKO_005 2433 CDS 100% 13.200 9.240 N Nbeal1 n/a
11 TRCN0000375529 CTAATTGAGCAGGTATCATTA pLKO_005 3662 CDS 100% 13.200 9.240 N Nbeal1 n/a
12 TRCN0000150906 GCTACAGATTACTGTGGAATA pLKO.1 8039 CDS 100% 10.800 7.560 N NBEAL1 n/a
13 TRCN0000144576 GAATATCTCTGCTTCCTGATA pLKO.1 792 CDS 100% 4.950 3.465 N NBEAL1 n/a
14 TRCN0000156779 GCCAGATTTCAGCTGGAGAAA pLKO.1 8733 CDS 100% 4.950 3.465 N NBEAL1 n/a
15 TRCN0000140350 CCTCCAGGAATATCTCTGCTT pLKO.1 785 CDS 100% 2.640 1.848 N NBEAL1 n/a
16 TRCN0000144418 CCTGATAATATTCTGCAGGTT pLKO.1 806 CDS 100% 2.640 1.848 N NBEAL1 n/a
17 TRCN0000140927 CCAGGAATATCTCTGCTTCCT pLKO.1 788 CDS 100% 0.264 0.158 N NBEAL1 n/a
18 TRCN0000145019 GAAAGATCCAGATTACCTGAA pLKO.1 679 CDS 100% 4.050 2.835 N NBEAL1 n/a
19 TRCN0000166364 CACACACACACACACACACAA pLKO.1 105 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496030.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.