Transcript: Mouse XM_006496053.2

PREDICTED: Mus musculus transmembrane protein 169 (Tmem169), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem169 (271711)
Length:
3064
CDS:
373..1266

Additional Resources:

NCBI RefSeq record:
XM_006496053.2
NBCI Gene record:
Tmem169 (271711)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496053.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125903 TCAGATAATGAGAAGACGGAT pLKO.1 541 CDS 100% 2.640 2.112 N Tmem169 n/a
2 TRCN0000125902 TCTTTCGTTGTGTCTTTCTAT pLKO.1 895 CDS 100% 5.625 3.938 N Tmem169 n/a
3 TRCN0000125899 GCACATAACTAAAGCCACAAA pLKO.1 1715 3UTR 100% 4.950 3.465 N Tmem169 n/a
4 TRCN0000125901 GCTCTCTTTCGTTGTGTCTTT pLKO.1 891 CDS 100% 4.950 3.465 N Tmem169 n/a
5 TRCN0000125900 TCTGATAATATCTCGGGCAAT pLKO.1 1198 CDS 100% 4.050 2.835 N Tmem169 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496053.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04586 pDONR223 100% 85.5% 87.8% None (many diffs) n/a
2 ccsbBroad304_04586 pLX_304 0% 85.5% 87.8% V5 (many diffs) n/a
3 TRCN0000477957 TACTGTATTATCAGGTGATGGGAG pLX_317 14.7% 85.5% 87.8% V5 (many diffs) n/a
Download CSV