Transcript: Mouse XM_006496220.3

PREDICTED: Mus musculus unc-50 homolog (C. elegans) (Unc50), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Unc50 (67387)
Length:
1270
CDS:
322..1101

Additional Resources:

NCBI RefSeq record:
XM_006496220.3
NBCI Gene record:
Unc50 (67387)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496220.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124128 CACGGGAATGGAGTATTAAAT pLKO.1 355 CDS 100% 15.000 21.000 N Unc50 n/a
2 TRCN0000124125 GCACGGGAATGGAGTATTAAA pLKO.1 354 CDS 100% 15.000 21.000 N Unc50 n/a
3 TRCN0000256713 CAAATTCAAGGTGATATTAAC pLKO_005 1185 3UTR 100% 13.200 18.480 N Unc50 n/a
4 TRCN0000256716 CCTTCTGATCTCAACGTTAAT pLKO_005 699 CDS 100% 13.200 18.480 N Unc50 n/a
5 TRCN0000124127 GCTCTTTCGATTTCGGCAGAT pLKO.1 432 CDS 100% 4.050 5.670 N Unc50 n/a
6 TRCN0000124126 GCTCCTCGTCATTCTGCATTT pLKO.1 819 CDS 100% 10.800 8.640 N Unc50 n/a
7 TRCN0000124124 CTAGAGAAACTGTCTGGTGTT pLKO.1 1107 3UTR 100% 4.050 3.240 N Unc50 n/a
8 TRCN0000256715 TTGATTGCTGTTGGCTATTAT pLKO_005 916 CDS 100% 15.000 10.500 N Unc50 n/a
9 TRCN0000256712 TGGCACTGGGATGGAACTTTA pLKO_005 1040 CDS 100% 13.200 9.240 N Unc50 n/a
10 TRCN0000256714 TTTAGTTGGAAATACCTTATG pLKO_005 894 CDS 100% 10.800 7.560 N Unc50 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496220.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02893 pDONR223 100% 86.7% 95.7% None (many diffs) n/a
2 ccsbBroad304_02893 pLX_304 0% 86.7% 95.7% V5 (many diffs) n/a
3 TRCN0000472180 CACCTTAGATAGAAAAGAGCAACT pLX_317 61.6% 86.7% 95.7% V5 (many diffs) n/a
Download CSV