Transcript: Mouse XM_006496326.2

PREDICTED: Mus musculus Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 (Raph1), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Raph1 (77300)
Length:
2601
CDS:
511..2550

Additional Resources:

NCBI RefSeq record:
XM_006496326.2
NBCI Gene record:
Raph1 (77300)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496326.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000282099 CTTATGATTGGACTTCGTTAT pLKO_005 2237 CDS 100% 10.800 15.120 N Raph1 n/a
2 TRCN0000262118 GAGCATCTGGTATCTACTATG pLKO_005 1931 CDS 100% 10.800 15.120 N Raph1 n/a
3 TRCN0000077861 GCTTATATTTATGGAGCGTAT pLKO.1 1710 CDS 100% 4.050 3.240 N RAPH1 n/a
4 TRCN0000262117 AGACTGCTGCCTGGCATTAAA pLKO_005 2061 CDS 100% 15.000 10.500 N Raph1 n/a
5 TRCN0000282104 ACGCCCTCAAGAGCTTGATTT pLKO_005 1194 CDS 100% 13.200 9.240 N Raph1 n/a
6 TRCN0000282100 GAAGCAGCTCTACACGAATTA pLKO_005 2187 CDS 100% 13.200 9.240 N Raph1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496326.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.