Transcript: Mouse XM_006496522.3

PREDICTED: Mus musculus predicted pseudogene 7609 (Gm7609), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm7609 (665378)
Length:
2806
CDS:
308..1198

Additional Resources:

NCBI RefSeq record:
XM_006496522.3
NBCI Gene record:
Gm7609 (665378)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496522.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272023 CAATACTTACCTCGCTATTTG pLKO_005 646 CDS 100% 13.200 6.600 Y Gm7609 n/a
2 TRCN0000271980 CTGCTGTGTTGGCTGGTATTT pLKO_005 569 CDS 100% 13.200 6.600 Y Gm7609 n/a
3 TRCN0000284608 GGGACTTGGACCACGGTTATA pLKO_005 722 CDS 100% 13.200 6.600 Y Gm7609 n/a
4 TRCN0000249701 TCAATACTTACCTCGCTATTT pLKO_005 645 CDS 100% 13.200 6.600 Y Csprs n/a
5 TRCN0000249699 TGCTGTGTTGGCTGGTATTTG pLKO_005 570 CDS 100% 13.200 6.600 Y Csprs n/a
6 TRCN0000272022 ACCGTTGTCATTATCGCAATA pLKO_005 413 CDS 100% 10.800 5.400 Y Gm7609 n/a
7 TRCN0000174272 CCTGTTTAGAAACTGTTCTTT pLKO.1 2219 3UTR 100% 5.625 2.813 Y Csprs n/a
8 TRCN0000193834 CTTGTTCATCTACTGCAGATA pLKO.1 977 CDS 100% 4.950 2.475 Y Csprs n/a
9 TRCN0000173867 GATCCTCCTTACTCTGACCTT pLKO.1 616 CDS 100% 2.640 1.320 Y Csprs n/a
10 TRCN0000249703 TACCTACCCTGATAATCATAG pLKO_005 1011 CDS 100% 0.000 0.000 Y Csprs n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496522.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.