Transcript: Mouse XM_006496548.2

PREDICTED: Mus musculus dynein assembly factor with WDR repeat domains 1 (Daw1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Daw1 (71227)
Length:
1690
CDS:
58..1305

Additional Resources:

NCBI RefSeq record:
XM_006496548.2
NBCI Gene record:
Daw1 (71227)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496548.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215749 GACATTATCTAAAGGTTATTG pLKO.1 1480 3UTR 100% 13.200 18.480 N Daw1 n/a
2 TRCN0000191082 CCAGGAATTATGCTGGAATAT pLKO.1 94 CDS 100% 13.200 9.240 N Daw1 n/a
3 TRCN0000191586 GCAGGCATAATATGTGTTAAA pLKO.1 1507 3UTR 100% 13.200 9.240 N Daw1 n/a
4 TRCN0000192430 CAGAGCACACATATTGCCATT pLKO.1 321 CDS 100% 4.050 2.835 N Daw1 n/a
5 TRCN0000189850 GCTCTGATAAGACAGCCAGAA pLKO.1 1148 CDS 100% 4.050 2.835 N Daw1 n/a
6 TRCN0000191391 CACAAGAAAGTGTGTAACCAA pLKO.1 1056 CDS 100% 3.000 2.100 N Daw1 n/a
7 TRCN0000192472 CGGCAAGAGTTTACAATGCAA pLKO.1 1034 CDS 100% 3.000 2.100 N Daw1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496548.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09760 pDONR223 100% 84.9% 89.6% None (many diffs) n/a
2 ccsbBroad304_09760 pLX_304 0% 84.9% 89.6% V5 (many diffs) n/a
3 TRCN0000491751 GCACTAATGCGGACGTACTGATTC pLX_317 34.7% 84.9% 89.6% V5 (many diffs) n/a
Download CSV