Transcript: Mouse XM_006496780.3

PREDICTED: Mus musculus TIP41, TOR signalling pathway regulator-like (S. cerevisiae) (Tiprl), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tiprl (226591)
Length:
2161
CDS:
647..1339

Additional Resources:

NCBI RefSeq record:
XM_006496780.3
NBCI Gene record:
Tiprl (226591)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496780.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241773 GACCTACATGTTACGAGAATA pLKO_005 1144 CDS 100% 13.200 18.480 N Tiprl n/a
2 TRCN0000241772 GTTTGTGAGAAGCTCGTATTT pLKO_005 1265 CDS 100% 13.200 18.480 N Tiprl n/a
3 TRCN0000216441 GACCTATACAACAGATTATAA pLKO.1 853 CDS 100% 15.000 12.000 N Tiprl n/a
4 TRCN0000241775 GACCTATACAACAGATTATAA pLKO_005 853 CDS 100% 15.000 12.000 N Tiprl n/a
5 TRCN0000202443 GCAGTTTGTGAGAAGCTCGTA pLKO.1 1262 CDS 100% 2.640 2.112 N Tiprl n/a
6 TRCN0000241774 GTACCTACAACAGATCATATA pLKO_005 911 CDS 100% 0.000 0.000 N Tiprl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496780.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09927 pDONR223 100% 45.7% 49% None (many diffs) n/a
2 ccsbBroad304_09927 pLX_304 0% 45.7% 49% V5 (many diffs) n/a
3 TRCN0000480703 TGATTGTTCACTGCCACGGAGCTA pLX_317 88.9% 45.7% 49% V5 (many diffs) n/a
Download CSV