Transcript: Mouse XM_006496837.1

PREDICTED: Mus musculus bone morphogenic protein/retinoic acid inducible neural-specific 2 (Brinp2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Brinp2 (240843)
Length:
3894
CDS:
610..2961

Additional Resources:

NCBI RefSeq record:
XM_006496837.1
NBCI Gene record:
Brinp2 (240843)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496837.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119358 CCGGATGCTATCCGAGATTTA pLKO.1 2689 CDS 100% 13.200 18.480 N Brinp2 n/a
2 TRCN0000119361 CCGATGGAAAGTGAACAACTT pLKO.1 888 CDS 100% 4.950 6.930 N Brinp2 n/a
3 TRCN0000119360 GCCTGTTAATGAGGGCAACTT pLKO.1 2418 CDS 100% 4.950 3.465 N Brinp2 n/a
4 TRCN0000119359 GCTGACATTCAGGCTATGGAA pLKO.1 1540 CDS 100% 3.000 2.100 N Brinp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496837.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03851 pDONR223 100% 90% 94.7% None (many diffs) n/a
2 ccsbBroad304_03851 pLX_304 0% 90% 94.7% V5 (many diffs) n/a
3 TRCN0000480535 CGTCGCCGTGGAGAATCTTTGATA pLX_317 17.8% 90% 94.7% V5 (many diffs) n/a
Download CSV