Transcript: Mouse XM_006496901.2

PREDICTED: Mus musculus olfactomedin-like 2B (Olfml2b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Olfml2b (320078)
Length:
3210
CDS:
500..2746

Additional Resources:

NCBI RefSeq record:
XM_006496901.2
NBCI Gene record:
Olfml2b (320078)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496901.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322496 ATGACAGTTTGGGTCTATATT pLKO_005 2888 3UTR 100% 15.000 21.000 N Olfml2b n/a
2 TRCN0000185311 GCATTTACGTAACCAACTATT pLKO.1 2073 CDS 100% 13.200 18.480 N Olfml2b n/a
3 TRCN0000322497 ACGTAACCAACTATTACTATG pLKO_005 2079 CDS 100% 10.800 15.120 N Olfml2b n/a
4 TRCN0000322498 TTGAAGCTGTCTACAATTATA pLKO_005 932 CDS 100% 15.000 10.500 N Olfml2b n/a
5 TRCN0000215612 GATTTGAAGCTGTCTACAATT pLKO.1 929 CDS 100% 13.200 9.240 N Olfml2b n/a
6 TRCN0000322495 TATGCTGTGGACAGCTATAAC pLKO_005 2543 CDS 100% 13.200 9.240 N Olfml2b n/a
7 TRCN0000217227 CCCGAAACATCATCAAGTATG pLKO.1 2238 CDS 100% 10.800 7.560 N Olfml2b n/a
8 TRCN0000322499 TATGACCTGAAGCAGCGTTAT pLKO_005 2255 CDS 100% 10.800 7.560 N Olfml2b n/a
9 TRCN0000229964 ATGCCTGCCAGAGGATCAATG pLKO_005 759 CDS 100% 10.800 7.560 N OLFML2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496901.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02881 pDONR223 100% 82.7% 82.4% None (many diffs) n/a
2 ccsbBroad304_02881 pLX_304 0% 82.7% 82.4% V5 (many diffs) n/a
3 TRCN0000470914 CGCTCAGCAAGTTGCCGCTCGAGA pLX_317 16.5% 82.7% 82.4% V5 (many diffs) n/a
Download CSV