Transcript: Mouse XM_006496958.1

PREDICTED: Mus musculus NUF2, NDC80 kinetochore complex component (Nuf2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nuf2 (66977)
Length:
2077
CDS:
199..1590

Additional Resources:

NCBI RefSeq record:
XM_006496958.1
NBCI Gene record:
Nuf2 (66977)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496958.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217458 GGATTCCTTTATGCCCATTTG pLKO.1 474 CDS 100% 10.800 15.120 N Nuf2 n/a
2 TRCN0000244489 CTATGTACTGGTTGGAATAAA pLKO_005 2023 3UTR 100% 15.000 12.000 N Nuf2 n/a
3 TRCN0000244486 TATCCCTGAGTTGAAACTATT pLKO_005 1766 3UTR 100% 13.200 10.560 N Nuf2 n/a
4 TRCN0000215805 CATAAGAATGACGACTGTAAA pLKO.1 1221 CDS 100% 13.200 9.240 N Nuf2 n/a
5 TRCN0000215593 GCTTCTGTTTGGCATAGTTAT pLKO.1 1630 3UTR 100% 13.200 9.240 N Nuf2 n/a
6 TRCN0000244487 GCTTCTGTTTGGCATAGTTAT pLKO_005 1630 3UTR 100% 13.200 9.240 N Nuf2 n/a
7 TRCN0000191541 GCTGAAGAACTATAAAGACAA pLKO.1 948 CDS 100% 4.950 3.465 N Nuf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496958.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.