Transcript: Mouse XM_006497033.2

PREDICTED: Mus musculus Ral GEF with PH domain and SH3 binding motif 2 (Ralgps2), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ralgps2 (78255)
Length:
7044
CDS:
694..2046

Additional Resources:

NCBI RefSeq record:
XM_006497033.2
NBCI Gene record:
Ralgps2 (78255)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497033.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295659 ACTAAGACGTGGGCGTTATTA pLKO_005 739 CDS 100% 15.000 21.000 N Ralgps2 n/a
2 TRCN0000110113 CGCGGGTCAGATAACACTAAT pLKO.1 327 5UTR 100% 13.200 18.480 N Ralgps2 n/a
3 TRCN0000288398 CGCGGGTCAGATAACACTAAT pLKO_005 327 5UTR 100% 13.200 18.480 N Ralgps2 n/a
4 TRCN0000295660 GACAGAAGAGGAGTGCTATTG pLKO_005 2055 3UTR 100% 10.800 7.560 N Ralgps2 n/a
5 TRCN0000110110 CCAGGGTTAAAGTTTAACTTT pLKO.1 2741 3UTR 100% 5.625 3.938 N Ralgps2 n/a
6 TRCN0000110114 GCAGTGATGGTTCTGAACTAA pLKO.1 1490 CDS 100% 5.625 3.938 N Ralgps2 n/a
7 TRCN0000288331 GCAGTGATGGTTCTGAACTAA pLKO_005 1490 CDS 100% 5.625 3.938 N Ralgps2 n/a
8 TRCN0000110111 CCACTATATTAAGACTGCTAA pLKO.1 639 5UTR 100% 4.950 3.465 N Ralgps2 n/a
9 TRCN0000110112 GCATTTCAAATCAACGTCAAA pLKO.1 1815 CDS 100% 4.950 3.465 N Ralgps2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497033.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03523 pDONR223 100% 66.3% 73.2% None (many diffs) n/a
2 ccsbBroad304_03523 pLX_304 0% 66.3% 73.2% V5 (many diffs) n/a
Download CSV