Transcript: Mouse XM_006497436.3

PREDICTED: Mus musculus FERM domain containing 4A (Frmd4a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Frmd4a (209630)
Length:
6491
CDS:
332..3517

Additional Resources:

NCBI RefSeq record:
XM_006497436.3
NBCI Gene record:
Frmd4a (209630)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497436.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437520 CCATTTGGGCGATGGCTATTA pLKO_005 1293 CDS 100% 13.200 18.480 N Frmd4a n/a
2 TRCN0000216739 GTTGACAGTGAAGTGGTATTT pLKO.1 773 CDS 100% 13.200 18.480 N Frmd4a n/a
3 TRCN0000174607 GTTCACTATTATGCAGTGAAA pLKO.1 1028 CDS 100% 0.495 0.396 N Frmd4a n/a
4 TRCN0000427088 GTGAAGCCAAGGAAGATATTT pLKO_005 1121 CDS 100% 15.000 10.500 N Frmd4a n/a
5 TRCN0000446206 AGCGTCAAAGCGCAGTTTAAG pLKO_005 2951 CDS 100% 13.200 9.240 N Frmd4a n/a
6 TRCN0000431389 ATATCAGTTTACACCTGAAAT pLKO_005 3937 3UTR 100% 13.200 9.240 N Frmd4a n/a
7 TRCN0000144135 CCAGTATGACTACCATGATAA pLKO.1 1099 CDS 100% 13.200 9.240 N FRMD4A n/a
8 TRCN0000175234 CCTGTAGAAGAGAACAAGAAA pLKO.1 3827 3UTR 100% 5.625 3.938 N Frmd4a n/a
9 TRCN0000174524 CTTCTGTGTCAGATTCTACAT pLKO.1 664 CDS 100% 4.950 3.465 N Frmd4a n/a
10 TRCN0000193973 GAGAATTGGAACAGCCTTCAA pLKO.1 1696 CDS 100% 4.950 3.465 N Frmd4a n/a
11 TRCN0000176359 CCCACTATGTTCATTCCACAA pLKO.1 2421 CDS 100% 4.050 2.835 N Frmd4a n/a
12 TRCN0000141074 CGACTATGACAAGTCACCCAT pLKO.1 2176 CDS 100% 2.640 1.848 N FRMD4A n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 256 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497436.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.