Transcript: Mouse XM_006497526.3

PREDICTED: Mus musculus family with sequence similarity 188, member A (Fam188a), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mindy3 (66960)
Length:
5941
CDS:
4332..5150

Additional Resources:

NCBI RefSeq record:
XM_006497526.3
NBCI Gene record:
Mindy3 (66960)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497526.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264565 GAGCGATTTCATGCATTAATT pLKO_005 4251 5UTR 100% 15.000 12.000 N Mindy3 n/a
2 TRCN0000056111 CAATGGATTGAAGCAGTCAAA pLKO.1 4967 CDS 100% 4.950 3.960 N MINDY3 n/a
3 TRCN0000264567 GACAGACGACACTCCTATTAA pLKO_005 5057 CDS 100% 15.000 10.500 N Mindy3 n/a
4 TRCN0000264566 ATTATAGACCCTGGCTATTTG pLKO_005 5598 3UTR 100% 13.200 9.240 N Mindy3 n/a
5 TRCN0000283083 GAAACTCACCTCACCGTATTT pLKO_005 4665 CDS 100% 13.200 9.240 N Mindy3 n/a
6 TRCN0000264568 TAATGGAAGCTTTACGATATT pLKO_005 4588 CDS 100% 13.200 9.240 N Mindy3 n/a
7 TRCN0000056109 GCCAAGGATATGGCTTTAGTT pLKO.1 4689 CDS 100% 5.625 3.938 N MINDY3 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1557 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497526.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04165 pDONR223 100% 56.6% 60% None (many diffs) n/a
2 ccsbBroad304_04165 pLX_304 0% 56.6% 60% V5 (many diffs) n/a
Download CSV