Transcript: Mouse XM_006497567.2

PREDICTED: Mus musculus cell division cycle 123 (Cdc123), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdc123 (98828)
Length:
1076
CDS:
52..603

Additional Resources:

NCBI RefSeq record:
XM_006497567.2
NBCI Gene record:
Cdc123 (98828)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497567.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257586 GACTTCACACAGCCGTTTATT pLKO_005 445 CDS 100% 15.000 21.000 N Cdc123 n/a
2 TRCN0000246991 AGTCCAAGAAGCTATCAATTC pLKO_005 285 CDS 100% 10.800 8.640 N Cdc123 n/a
3 TRCN0000184806 CGAAGCCTTACCATCAAGAGT pLKO.1 106 CDS 100% 3.000 2.400 N Cdc123 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497567.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02035 pDONR223 100% 43.8% 40.1% None (many diffs) n/a
2 ccsbBroad304_02035 pLX_304 0% 43.8% 40.1% V5 (many diffs) n/a
3 TRCN0000480768 GCTTCAGACCTGTGGTAAGAAAAT pLX_317 45.2% 43.8% 40.1% V5 (many diffs) n/a
Download CSV