Construct: ORF TRCN0000480768
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010459.1_s317c1
- Derived from:
- ccsbBroadEn_02035
- DNA Barcode:
- GCTTCAGACCTGTGGTAAGAAAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CDC123 (8872)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480768
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8872 | CDC123 | cell division cycle 123 | NM_006023.3 | 100% | 100% | |
| 2 | human | 8872 | CDC123 | cell division cycle 123 | XM_005252638.4 | 90.4% | 90.4% | 236_237ins96 |
| 3 | mouse | 98828 | Cdc123 | cell division cycle 123 | NM_133837.4 | 87.9% | 92.2% | (many diffs) |
| 4 | mouse | 98828 | Cdc123 | cell division cycle 123 | XM_006497564.1 | 85% | 89.2% | (many diffs) |
| 5 | mouse | 98828 | Cdc123 | cell division cycle 123 | XM_006497565.1 | 76.7% | 80.6% | (many diffs) |
| 6 | mouse | 98828 | Cdc123 | cell division cycle 123 | XM_006497566.2 | 46.7% | 42.9% | (many diffs) |
| 7 | mouse | 98828 | Cdc123 | cell division cycle 123 | XM_006497567.2 | 43.8% | 40.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1074
- ORF length:
- 1008
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa gaaggagcat gtgcttcact gccagttctc cgcgtggtac ccgttcttcc 121 gaggcgttac catcaagagt gtcattcttc cacttcctca gaatgtgaag gattatttac 181 tcgatgatgg aactctggtg gtttcaggaa gggatgatcc accaacacat tctcagccag 241 acagtgatga tgaagcagaa gaaatacagt ggtctgatga tgagaacaca gccacgctta 301 cggcaccaga atttcctgag tttgccacta aagtccagga agctatcaat tccctcgggg 361 gcagtgtctt tcctaagctt aattggagtg ccccaaggga tgcgtattgg atagcaatga 421 atagttctct gaaatgtaaa accctcagcg acatctttct gcttttcaag agttccgatt 481 tcatcactcg tgacttcact cagccgttta ttcattgtac tgatgattct ccagatccat 541 gtatagaata tgagctcgtt ctccgaaaat ggtgtgaatt gattcctggg gctgagtttc 601 gatgttttgt caaggaaaaC AAGCTTATTG GTATTTCTCA AAGAGACTAC ACACAATACT 661 ATGATCATAT TTCTAAACAA AAGGAAGAAA TTCGCAGATG CATACAAGAC TTTTTCAAGA 721 AACACATACA GTACAAATTC TTAGATGAAG ACTTTGTGTT CGATATATAC AGAGACAGTA 781 GGGGGAAGGT GTGGCTCATT GACTTTAATC CATTTGGTGA AGTCACAGAT TCACTGCTGT 841 TCACCTGGGA AGAACTGATA TCTGAGAACA ACTTAAACGG CGATTTTAGT GAAGTTGACG 901 CTCAAGAGCA GGATTCCCCA GCTTTCCGTT GCACAAACAG TGAAGTGACA GTCCAGCCCA 961 GCCCCTATTT GAGTTACCGG CTACCCAAGG ACTTTGTAGA CCTCTCTACT GGGGAGGACG 1021 CTCACAAGCT AATAGACTTC CTTAAGCTGA AGAGAAATCA GCAGGAGGAC GACTGCCCAA 1081 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1141 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1201 TATCTTGTGG AAAGGACGAG CTTCAGACCT GTGGTAAGAA AATACGCGTT AAGTCgacaa 1261 tcaacctctg gattacaaaa tttgtgaaag att