Transcript: Mouse XM_006497644.3

PREDICTED: Mus musculus collagen, type V, alpha 1 (Col5a1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Col5a1 (12831)
Length:
8075
CDS:
422..5938

Additional Resources:

NCBI RefSeq record:
XM_006497644.3
NBCI Gene record:
Col5a1 (12831)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497644.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090002 GCCTACCGAGTCTCTAAAGAT pLKO.1 641 CDS 100% 5.625 7.875 N Col5a1 n/a
2 TRCN0000317145 GCCTACCGAGTCTCTAAAGAT pLKO_005 641 CDS 100% 5.625 7.875 N Col5a1 n/a
3 TRCN0000089999 CCTATTACTATGAGTATCCAT pLKO.1 1230 CDS 100% 3.000 4.200 N Col5a1 n/a
4 TRCN0000313469 AGGAGAGGGTGAGACCTATTA pLKO_005 1216 CDS 100% 13.200 9.240 N Col5a1 n/a
5 TRCN0000313468 ACGTGCCTTTCCGATGGATTA pLKO_005 6404 3UTR 100% 10.800 7.560 N Col5a1 n/a
6 TRCN0000313467 ACTACTATGACCCGTACTTTG pLKO_005 1653 CDS 100% 10.800 7.560 N Col5a1 n/a
7 TRCN0000090000 CCCGGATTCTGGATGATGAAA pLKO.1 1047 CDS 100% 5.625 3.938 N Col5a1 n/a
8 TRCN0000317146 CCCGGATTCTGGATGATGAAA pLKO_005 1047 CDS 100% 5.625 3.938 N Col5a1 n/a
9 TRCN0000089998 CCCAGAGAGAACAAAGGGAAA pLKO.1 6096 3UTR 100% 4.050 2.835 N Col5a1 n/a
10 TRCN0000090001 GACATCATGTTCAACGACTTT pLKO.1 5861 CDS 100% 4.950 2.970 N Col5a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497644.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000475520 AATCCCCTTTCCAAGTACGAATCA pLX_317 4.2% 28% 30.9% V5 (many diffs) n/a
Download CSV