Transcript: Mouse XM_006497731.3

PREDICTED: Mus musculus potassium inwardly-rectifying channel, subfamily J, member 3 (Kcnj3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kcnj3 (16519)
Length:
2728
CDS:
1849..2661

Additional Resources:

NCBI RefSeq record:
XM_006497731.3
NBCI Gene record:
Kcnj3 (16519)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497731.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069736 GCGTTGGAACCTCTTTATCTT pLKO.1 2088 CDS 100% 5.625 7.875 N Kcnj3 n/a
2 TRCN0000044330 CCAATGTCTATAACTTCCCTT pLKO.1 2222 CDS 100% 2.640 2.112 N KCNJ3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497731.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06476 pDONR223 100% 50.4% 48.2% None (many diffs) n/a
2 ccsbBroad304_06476 pLX_304 0% 50.4% 48.2% V5 (many diffs) n/a
3 TRCN0000468883 TTGTGATAATGCCGACTGATAATT pLX_317 29.6% 50.4% 48.2% V5 (many diffs) n/a
Download CSV