Transcript: Mouse XM_006498002.3

PREDICTED: Mus musculus DENN/MADD domain containing 1A (Dennd1a), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dennd1a (227801)
Length:
4485
CDS:
302..3442

Additional Resources:

NCBI RefSeq record:
XM_006498002.3
NBCI Gene record:
Dennd1a (227801)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498002.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249256 TGAAGCTTGCTCATCCATATA pLKO_005 2277 CDS 100% 13.200 10.560 N Dennd1a n/a
2 TRCN0000141749 GCAAACAGAGATTCGGGTTCT pLKO.1 444 CDS 100% 4.050 3.240 N DENND1A n/a
3 TRCN0000249255 ACACCAGCAACTCTAACTTAT pLKO_005 3980 3UTR 100% 13.200 9.240 N Dennd1a n/a
4 TRCN0000249254 AGACTACATTTGAAGTGTATG pLKO_005 284 5UTR 100% 10.800 7.560 N Dennd1a n/a
5 TRCN0000249257 ATTCGGGTTCTGCCGCTTATC pLKO_005 454 CDS 100% 10.800 7.560 N Dennd1a n/a
6 TRCN0000350941 ATTCGGGTTCTGCCGCTTATC pLKO_005 454 CDS 100% 10.800 7.560 N DENND1A n/a
7 TRCN0000192295 CGATGTCTTTGAGGAGGAAAT pLKO.1 1351 CDS 100% 10.800 7.560 N Dennd1a n/a
8 TRCN0000201104 CCAGCATACCTGAGAATAGAA pLKO.1 696 CDS 100% 5.625 3.938 N Dennd1a n/a
9 TRCN0000249253 TACCTCATAGGAATCCATTTA pLKO_005 938 CDS 100% 0.000 0.000 N Dennd1a n/a
10 TRCN0000338586 TACCTCATAGGAATCCATTTA pLKO_005 938 CDS 100% 0.000 0.000 N DENND1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498002.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03844 pDONR223 100% 43.7% 41.1% None (many diffs) n/a
2 ccsbBroad304_03844 pLX_304 0% 43.7% 41.1% V5 (many diffs) n/a
3 TRCN0000481037 TATGGCCGATTTACATGACTCTCC pLX_317 25.9% 43.7% 41.1% V5 (many diffs) n/a
Download CSV