Transcript: Mouse XM_006498066.3

PREDICTED: Mus musculus origin recognition complex, subunit 4 (Orc4), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Orc4 (26428)
Length:
3903
CDS:
189..1316

Additional Resources:

NCBI RefSeq record:
XM_006498066.3
NBCI Gene record:
Orc4 (26428)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498066.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238278 TAACCGTATCACACCCATTTA pLKO_005 874 CDS 100% 13.200 18.480 N Orc4 n/a
2 TRCN0000238277 TTGGATTCTAAGGCGAATATT pLKO_005 936 CDS 100% 15.000 12.000 N Orc4 n/a
3 TRCN0000238275 GATCAGGAAAGACCACATTAT pLKO_005 391 CDS 100% 13.200 9.240 N Orc4 n/a
4 TRCN0000238276 TATCAAGGTCATACAAGTATA pLKO_005 2530 3UTR 100% 13.200 9.240 N Orc4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498066.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01125 pDONR223 100% 75.9% 76.8% None (many diffs) n/a
2 ccsbBroad304_01125 pLX_304 0% 75.9% 76.8% V5 (many diffs) n/a
3 TRCN0000480371 CCGGTCCTATGTCCGGGTCCGCGT pLX_317 26.2% 75.9% 76.8% V5 (many diffs) n/a
Download CSV