Transcript: Mouse XM_006498132.2

PREDICTED: Mus musculus cilia and flagella associated protein 77 (Cfap77), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cfap77 (329375)
Length:
1198
CDS:
267..1118

Additional Resources:

NCBI RefSeq record:
XM_006498132.2
NBCI Gene record:
Cfap77 (329375)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498132.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267161 TCGTGCGTGACTCCATGTTTC pLKO_005 421 CDS 100% 10.800 15.120 N Cfap77 n/a
2 TRCN0000283480 TACGGGCATGGAGAACGAAAG pLKO_005 392 CDS 100% 6.000 4.200 N Cfap77 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498132.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13662 pDONR223 100% 84.1% 87.6% None (many diffs) n/a
2 ccsbBroad304_13662 pLX_304 0% 84.1% 87.6% V5 (many diffs) n/a
3 ccsbBroadEn_14495 pDONR223 100% 83.8% 87.3% None (many diffs) n/a
4 ccsbBroad304_14495 pLX_304 0% 83.8% 87.3% V5 (many diffs) n/a
5 TRCN0000479918 ATTTTATCCCTTGATTGCTTAGGA pLX_317 38.6% 83.8% 87.3% V5 (many diffs) n/a
Download CSV