Transcript: Mouse XM_006498370.1

PREDICTED: Mus musculus multivesicular body subunit 12B (Mvb12b), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mvb12b (72543)
Length:
4877
CDS:
548..1459

Additional Resources:

NCBI RefSeq record:
XM_006498370.1
NBCI Gene record:
Mvb12b (72543)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498370.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177516 CGTAAGACCAAATCTAAGAAT pLKO.1 3939 3UTR 100% 5.625 7.875 N Mvb12b n/a
2 TRCN0000198252 GCGGCTCTGCATTAAGTTTAT pLKO.1 973 CDS 100% 13.200 9.240 N Mvb12b n/a
3 TRCN0000181303 CCAGGGTTGATTGCTTCACTT pLKO.1 1809 3UTR 100% 4.950 3.465 N Mvb12b n/a
4 TRCN0000177450 CGTTGTTCATAATTGTGACTA pLKO.1 1585 3UTR 100% 4.950 3.465 N Mvb12b n/a
5 TRCN0000128336 GATACCTGTGTTTCACAAGAT pLKO.1 816 CDS 100% 4.950 3.465 N MVB12B n/a
6 TRCN0000197386 CCTGTGTTTCACAAGATCATT pLKO.1 820 CDS 100% 5.625 3.375 N Mvb12b n/a
7 TRCN0000176910 GCTTATTCAAGTCCAAGGTTA pLKO.1 792 CDS 100% 4.950 2.970 N Mvb12b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498370.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09277 pDONR223 100% 64.4% 69.8% None (many diffs) n/a
Download CSV