Transcript: Mouse XM_006498379.2

PREDICTED: Mus musculus PHD finger protein 19 (Phf19), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Phf19 (74016)
Length:
3850
CDS:
147..1883

Additional Resources:

NCBI RefSeq record:
XM_006498379.2
NBCI Gene record:
Phf19 (74016)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498379.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096072 CCTAGCCAGTATATTCGACTT pLKO.1 1394 CDS 100% 4.050 5.670 N Phf19 n/a
2 TRCN0000096071 GCTCTCTATAACTTGGGAGTA pLKO.1 939 CDS 100% 4.050 2.835 N Phf19 n/a
3 TRCN0000096073 CCTCAAGTCCTCTATCACCAA pLKO.1 1742 CDS 100% 2.640 1.848 N Phf19 n/a
4 TRCN0000096070 CGGGCTATATTACCTTGGCAA pLKO.1 296 CDS 100% 2.640 1.848 N Phf19 n/a
5 TRCN0000096069 CCCTTCAGAAAGGAAGGCTTT pLKO.1 2891 3UTR 100% 0.405 0.243 N Phf19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498379.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02924 pDONR223 100% 87.2% 88.7% None (many diffs) n/a
2 ccsbBroad304_02924 pLX_304 0% 87.2% 88.7% V5 (many diffs) n/a
3 TRCN0000465955 CGAGCAGACAGACTAGGCTGCGCA pLX_317 22% 87.2% 88.7% V5 (many diffs) n/a
Download CSV