Transcript: Mouse XM_006498544.3

PREDICTED: Mus musculus ovo like zinc finger 2 (Ovol2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ovol2 (107586)
Length:
1260
CDS:
401..832

Additional Resources:

NCBI RefSeq record:
XM_006498544.3
NBCI Gene record:
Ovol2 (107586)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498544.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085914 CGACAACTCTGTGATTCACAA pLKO.1 343 5UTR 100% 4.950 3.960 N Ovol2 n/a
2 TRCN0000085913 GCCACGTTTACTCCGACTTAT pLKO.1 869 3UTR 100% 13.200 9.240 N Ovol2 n/a
3 TRCN0000085916 CATGCTCAACCGTCACCTTAA pLKO.1 400 5UTR 100% 10.800 7.560 N Ovol2 n/a
4 TRCN0000421364 CAACAGGCCCTGTGAATTGTT pLKO_005 1003 3UTR 100% 5.625 3.938 N Ovol2 n/a
5 TRCN0000433238 TTGGGACAGCAACAGTAAGAA pLKO_005 953 3UTR 100% 5.625 3.938 N Ovol2 n/a
6 TRCN0000085915 GCGACAACTCTGTGATTCACA pLKO.1 342 5UTR 100% 3.000 2.100 N Ovol2 n/a
7 TRCN0000085917 CTGCATGTGAACAGTGACCAT pLKO.1 695 CDS 100% 2.640 1.848 N Ovol2 n/a
8 TRCN0000425419 GACCTTTGTGGCAAGAGCTTC pLKO_005 368 5UTR 100% 4.050 2.430 N Ovol2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498544.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03864 pDONR223 100% 44.9% 48.3% None (many diffs) n/a
2 ccsbBroad304_03864 pLX_304 0% 44.9% 48.3% V5 (many diffs) n/a
3 TRCN0000472531 GCAAGGTGGTGTTTACCTGCATCA pLX_317 45.6% 44.9% 48.3% V5 (many diffs) n/a
Download CSV