Transcript: Mouse XM_006498650.3

PREDICTED: Mus musculus CD59a antigen (Cd59a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cd59a (12509)
Length:
1844
CDS:
296..667

Additional Resources:

NCBI RefSeq record:
XM_006498650.3
NBCI Gene record:
Cd59a (12509)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498650.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101166 CCAGTTTAACTTGTGTAACAA pLKO.1 559 CDS 100% 5.625 7.875 N Cd59a n/a
2 TRCN0000101169 AGATTGTCATGGTGAGATCAT pLKO.1 496 CDS 100% 4.950 6.930 N Cd59a n/a
3 TRCN0000329291 TTGTCATGGTGAGATCATTAT pLKO_005 499 CDS 100% 13.200 10.560 N Cd59a n/a
4 TRCN0000329359 ATTCAGATGCTGCCAGTTTAA pLKO_005 547 CDS 100% 13.200 9.240 N Cd59a n/a
5 TRCN0000329292 CTGCTGCTGCAGTAGTCTAAA pLKO_005 718 3UTR 100% 13.200 9.240 N Cd59a n/a
6 TRCN0000329289 GGTGGTTTCTTCATGCAATAT pLKO_005 391 CDS 100% 13.200 9.240 N Cd59a n/a
7 TRCN0000101168 CGGTGGTTTCTTCATGCAATA pLKO.1 390 CDS 100% 10.800 7.560 N Cd59a n/a
8 TRCN0000101165 CCCGCCTCTAAATAAATAAAT pLKO.1 1625 3UTR 100% 15.000 9.000 N Cd59a n/a
9 TRCN0000329358 CGGAATGCAAGTGTATCAAAG pLKO_005 460 CDS 100% 10.800 6.480 N Cd59a n/a
10 TRCN0000101167 GTGAGATCATTATGGACCAAT pLKO.1 507 CDS 100% 4.950 2.970 N Cd59a n/a
11 TRCN0000015008 CCAACCAACCAACCAACCAAA pLKO.1 1173 3UTR 100% 4.950 2.475 Y HMBOX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498650.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.