Transcript: Mouse XM_006498691.4

PREDICTED: Mus musculus dipeptidylpeptidase 4 (Dpp4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Dpp4 (13482)
Length:
3019
CDS:
522..2570

Additional Resources:

NCBI RefSeq record:
XM_006498691.4
NBCI Gene record:
Dpp4 (13482)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498691.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031290 CGTATTCACTAGCTGACTATT pLKO.1 640 CDS 100% 13.200 18.480 N Dpp4 n/a
2 TRCN0000452871 ATAAGATCATCAGCGACAAAG pLKO_005 1618 CDS 100% 10.800 15.120 N Dpp4 n/a
3 TRCN0000442417 CAGTATTATGCGGTATCATTT pLKO_005 1866 CDS 100% 13.200 9.240 N Dpp4 n/a
4 TRCN0000031291 CCAAGAAATATCCTCTACTAT pLKO.1 2113 CDS 100% 5.625 3.938 N Dpp4 n/a
5 TRCN0000031293 GCATGCAATCAACAGAAGATT pLKO.1 2276 CDS 100% 5.625 3.938 N Dpp4 n/a
6 TRCN0000031289 GCTCATTGAATACTCCTTCTA pLKO.1 1205 CDS 100% 4.950 3.465 N Dpp4 n/a
7 TRCN0000050774 CCAGAAGACAACCTTGACCAT pLKO.1 2529 CDS 100% 2.640 1.584 N DPP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498691.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06116 pDONR223 100% 75.6% 74.5% None (many diffs) n/a
2 ccsbBroad304_06116 pLX_304 0% 75.6% 74.5% V5 (many diffs) n/a
3 TRCN0000477379 AAACCAAAAGACTGACGCAGTGGA pLX_317 16.9% 75.6% 74.5% V5 (many diffs) n/a
Download CSV