Transcript: Mouse XM_006498814.2

PREDICTED: Mus musculus kinesin family member 16B (Kif16b), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kif16b (16558)
Length:
8043
CDS:
224..5815

Additional Resources:

NCBI RefSeq record:
XM_006498814.2
NBCI Gene record:
Kif16b (16558)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498814.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252035 ATCAACAAGCCTACCATTAAT pLKO_005 1298 CDS 100% 15.000 21.000 N Kif16b n/a
2 TRCN0000252036 GACCGTACGTTGAGGATTTAT pLKO_005 765 CDS 100% 15.000 21.000 N Kif16b n/a
3 TRCN0000074492 CGCTATGCAAATAGAGCCAAA pLKO.1 1271 CDS 100% 4.050 5.670 N KIF16B n/a
4 TRCN0000252038 ACCAACATGTTCCGCTTTAAC pLKO_005 1859 CDS 100% 13.200 9.240 N Kif16b n/a
5 TRCN0000252037 GTGGATGCCACGCAGCTAAAT pLKO_005 1811 CDS 100% 13.200 9.240 N Kif16b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498814.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12234 pDONR223 100% 32.4% 34.8% None (many diffs) n/a
2 ccsbBroad304_12234 pLX_304 0% 32.4% 34.8% V5 (many diffs) n/a
3 TRCN0000468768 ACGACCCCGTTCCCTTAATACACA pLX_317 20.4% 32.4% 34.8% V5 (many diffs) n/a
Download CSV