Transcript: Mouse XM_006499033.3

PREDICTED: Mus musculus sodium channel, voltage-gated, type IX, alpha (Scn9a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Scn9a (20274)
Length:
9996
CDS:
704..6658

Additional Resources:

NCBI RefSeq record:
XM_006499033.3
NBCI Gene record:
Scn9a (20274)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499033.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215484 GCGTTGGTCAATGATTCTTTA pLKO.1 6834 3UTR 100% 13.200 18.480 N Scn9a n/a
2 TRCN0000216783 GGTGACTCACTCGTGTTAATA pLKO.1 6695 3UTR 100% 15.000 12.000 N Scn9a n/a
3 TRCN0000173720 CTTCGTTCACAGATGGAAGAA pLKO.1 6272 CDS 100% 4.950 3.960 N Scn9a n/a
4 TRCN0000215944 CTTCATCAATTTGCCTATAAA pLKO.1 8318 3UTR 100% 15.000 10.500 N Scn9a n/a
5 TRCN0000175671 GATGACGATTTGCCCAATAAA pLKO.1 6464 CDS 100% 15.000 10.500 N Scn9a n/a
6 TRCN0000215387 CAAATTCCAAGGATGCATATT pLKO.1 5203 CDS 100% 13.200 9.240 N Scn9a n/a
7 TRCN0000069393 GCTGCTGAGTACACGAGTTTA pLKO.1 2033 CDS 100% 13.200 9.240 N LOC269279 n/a
8 TRCN0000069395 GCCAACATCGAAGAAGCTAAA pLKO.1 1934 CDS 100% 10.800 7.560 N LOC269279 n/a
9 TRCN0000069396 CCTTGAGCAGAATGAAACATT pLKO.1 1540 CDS 100% 5.625 3.938 N LOC269279 n/a
10 TRCN0000175091 GATTTGCCCAATAAAGAAGAT pLKO.1 6470 CDS 100% 4.950 3.465 N Scn9a n/a
11 TRCN0000069397 GCAGATGTTAGACCGACTCAA pLKO.1 1975 CDS 100% 4.950 3.465 N LOC269279 n/a
12 TRCN0000069394 GCTGATGATGAGCATAGCATT pLKO.1 2411 CDS 100% 4.950 3.465 N LOC269279 n/a
13 TRCN0000194178 GAAAGGTTTATGTCAGCCAAT pLKO.1 6290 CDS 100% 4.050 2.835 N Scn9a n/a
14 TRCN0000044503 GCCCTCATTGAACAACGCATT pLKO.1 764 CDS 100% 4.050 2.835 N SCN9A n/a
15 TRCN0000175974 GAAAGACGAAAGCAGGAAATA pLKO.1 6637 CDS 100% 13.200 7.920 N Scn9a n/a
16 TRCN0000173545 GCTGTTTGGAAAGAGCTACAA pLKO.1 3358 CDS 100% 4.950 2.475 Y Scn3a n/a
17 TRCN0000173685 CCAGTTCATAGAGTTCTGCAA pLKO.1 6079 CDS 100% 2.640 1.320 Y Scn9a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499033.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.