Transcript: Mouse XM_006499127.2

PREDICTED: Mus musculus WAS/WASL interacting protein family, member 1 (Wipf1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wipf1 (215280)
Length:
4635
CDS:
354..1835

Additional Resources:

NCBI RefSeq record:
XM_006499127.2
NBCI Gene record:
Wipf1 (215280)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499127.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422805 GATTCTACTTCCATCCGATTT pLKO_005 1681 CDS 100% 10.800 15.120 N WIPF1 n/a
2 TRCN0000418002 TCCTGAGCTATTGCTTGTATC pLKO_005 2033 3UTR 100% 10.800 15.120 N Wipf1 n/a
3 TRCN0000445424 ACCGCCAACAGGGATAATGAT pLKO_005 696 CDS 100% 5.625 7.875 N Wipf1 n/a
4 TRCN0000423142 GCCGAAGTGGATCCAACAGAA pLKO_005 1774 CDS 100% 4.950 6.930 N Wipf1 n/a
5 TRCN0000445638 GGTTACAGAACGTCCGATCTT pLKO_005 2215 3UTR 100% 4.950 6.930 N Wipf1 n/a
6 TRCN0000184459 GTACCGACAACCAAGACGTAT pLKO.1 1728 CDS 100% 0.000 0.000 N Wipf1 n/a
7 TRCN0000195856 CCCTCCACATCAGTTCGAAAT pLKO.1 1620 CDS 100% 10.800 7.560 N Wipf1 n/a
8 TRCN0000436021 CGTTCTACCCAAGCTCCAAAG pLKO_005 1849 3UTR 100% 6.000 4.200 N Wipf1 n/a
9 TRCN0000183384 GCCTAGCTGTTTATGTTGTAT pLKO.1 2008 3UTR 100% 5.625 3.938 N Wipf1 n/a
10 TRCN0000425268 TCCAGCTTCCAACGACGAGAT pLKO_005 1295 CDS 100% 4.050 2.835 N Wipf1 n/a
11 TRCN0000183172 GAAAGCAGATTCTACTTCCAT pLKO.1 1674 CDS 100% 3.000 1.800 N Wipf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499127.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.