Transcript: Mouse XM_006499465.2

PREDICTED: Mus musculus family with sequence similarity 171, member B (Fam171b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam171b (241520)
Length:
5869
CDS:
597..2834

Additional Resources:

NCBI RefSeq record:
XM_006499465.2
NBCI Gene record:
Fam171b (241520)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499465.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125289 GCTTAGAAACAACCTGATAAA pLKO.1 3260 3UTR 100% 13.200 18.480 N Fam171b n/a
2 TRCN0000125291 CCTCAGATTGGAGCCGATATT pLKO.1 2203 CDS 100% 13.200 9.240 N Fam171b n/a
3 TRCN0000125293 CACTCCTTTATAGACCTGAAA pLKO.1 2409 CDS 100% 4.950 3.465 N Fam171b n/a
4 TRCN0000125290 CCCTTCTACATACAAGTAATA pLKO.1 1183 CDS 100% 13.200 7.920 N Fam171b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499465.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13341 pDONR223 100% 77.5% 80.2% None (many diffs) n/a
2 ccsbBroad304_13341 pLX_304 0% 77.5% 80.2% V5 (many diffs) n/a
3 TRCN0000466410 AGAACAACCTTTAAGGACCCCTCA pLX_317 16.5% 77.5% 80.2% V5 (many diffs) n/a
Download CSV