Transcript: Mouse XM_006499602.3

PREDICTED: Mus musculus solute carrier family 28 (sodium-coupled nucleoside transporter), member 2 (Slc28a2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc28a2 (269346)
Length:
2500
CDS:
158..1900

Additional Resources:

NCBI RefSeq record:
XM_006499602.3
NBCI Gene record:
Slc28a2 (269346)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499602.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079325 AGATGCTTGAAGCCTCTGGAA pLKO.1 320 CDS 100% 2.640 1.848 N Slc28a2 n/a
2 TRCN0000079324 GCGGAAATCTTGAGCAAAGAT pLKO.1 98 5UTR 100% 0.563 0.394 N Slc28a2 n/a
3 TRCN0000262711 GCTGAAATCATTACAACATTT pLKO_005 1496 CDS 100% 13.200 6.600 Y Gm14085 n/a
4 TRCN0000282398 TCCGGTTACCAGACATGAAAT pLKO_005 2077 3UTR 100% 13.200 6.600 Y Gm14085 n/a
5 TRCN0000262710 TTCAGTCTCTGCCAATCATTA pLKO_005 699 CDS 100% 13.200 6.600 Y Gm14085 n/a
6 TRCN0000282401 TTCGGATGTGTGATGTCTATT pLKO_005 725 CDS 100% 13.200 6.600 Y Gm14085 n/a
7 TRCN0000262709 GAGTAGAAGAGTGGATCAATG pLKO_005 1449 CDS 100% 10.800 5.400 Y Gm14085 n/a
8 TRCN0000079323 CGCTCCAAGACAGTTCTCATA pLKO.1 1912 3UTR 100% 4.950 2.475 Y Slc28a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499602.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07367 pDONR223 100% 73.9% 72.9% None (many diffs) n/a
2 ccsbBroad304_07367 pLX_304 0% 73.9% 72.9% V5 (many diffs) n/a
3 TRCN0000479323 GGCTCCTCGACCCTCTAACCGCAC pLX_317 22.8% 73.9% 72.9% V5 (many diffs) n/a
4 TRCN0000488693 GCCGGCGAGTATAGGGCATCAAAG pLX_317 17.5% 73.9% 72.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV