Transcript: Mouse XM_006499657.3

PREDICTED: Mus musculus SHC (Src homology 2 domain containing) family, member 4 (Shc4), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Shc4 (271849)
Length:
3653
CDS:
392..1477

Additional Resources:

NCBI RefSeq record:
XM_006499657.3
NBCI Gene record:
Shc4 (271849)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499657.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415377 GAATGGCCCAAGACGTCATAA pLKO_005 570 CDS 100% 13.200 18.480 N SHC4 n/a
2 TRCN0000439227 GAATGGCCCAAGACGTCATAA pLKO_005 570 CDS 100% 13.200 18.480 N Shc4 n/a
3 TRCN0000114707 GCGGTGTGTATAAGAACTGTA pLKO.1 852 CDS 100% 4.950 6.930 N Shc4 n/a
4 TRCN0000412801 TACGTGCCTTTACCTTGATAA pLKO_005 1810 3UTR 100% 13.200 9.240 N Shc4 n/a
5 TRCN0000439153 GCTCAAGCTACAGACCAAATG pLKO_005 773 CDS 100% 10.800 7.560 N Shc4 n/a
6 TRCN0000114697 GCCTTTGAACTCCGGTTCAAA pLKO.1 605 CDS 100% 0.563 0.281 Y Shc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499657.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.