Transcript: Mouse XM_006499883.3

PREDICTED: Mus musculus growth factor receptor bound protein 14 (Grb14), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Grb14 (50915)
Length:
1771
CDS:
179..1540

Additional Resources:

NCBI RefSeq record:
XM_006499883.3
NBCI Gene record:
Grb14 (50915)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499883.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097179 CCAAACTGTGTGTCACTCGTT pLKO.1 1541 CDS 100% 2.640 2.112 N Grb14 n/a
2 TRCN0000349929 GGATGCAAAGGAGAATGATTA pLKO_005 1579 3UTR 100% 13.200 9.240 N Grb14 n/a
3 TRCN0000097182 TCCCTATGGATTCTGCTTAAA pLKO.1 823 CDS 100% 13.200 9.240 N Grb14 n/a
4 TRCN0000097180 CTCCCTATGGATTCTGCTTAA pLKO.1 822 CDS 100% 10.800 7.560 N Grb14 n/a
5 TRCN0000317251 CTCCCTATGGATTCTGCTTAA pLKO_005 822 CDS 100% 10.800 7.560 N Grb14 n/a
6 TRCN0000313737 TCCAAGGAACCACGGCATTTG pLKO_005 728 CDS 100% 10.800 7.560 N Grb14 n/a
7 TRCN0000097183 CACCTATCTCACATAGGTTTA pLKO.1 377 CDS 100% 1.080 0.756 N Grb14 n/a
8 TRCN0000317250 CACCTATCTCACATAGGTTTA pLKO_005 377 CDS 100% 1.080 0.756 N Grb14 n/a
9 TRCN0000097181 GCACCTATCTCACATAGGTTT pLKO.1 376 CDS 100% 0.495 0.347 N Grb14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499883.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000478548 GGTTAAGATAAAGCCTCCCTTCAA pLX_317 25.3% 71.2% 69.9% V5 (many diffs) n/a
2 ccsbBroadEn_06325 pDONR223 100% 71.1% 69.9% None (many diffs) n/a
3 ccsbBroad304_06325 pLX_304 0% 71.1% 69.9% V5 (many diffs) n/a
Download CSV