Transcript: Mouse XM_006499947.2

PREDICTED: Mus musculus zinc finger CCCH type containing 8 (Zc3h8), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zc3h8 (57432)
Length:
1619
CDS:
161..1066

Additional Resources:

NCBI RefSeq record:
XM_006499947.2
NBCI Gene record:
Zc3h8 (57432)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499947.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108629 GCTGGTCACAAGAAAGTTAAA pLKO.1 584 CDS 100% 13.200 18.480 N Zc3h8 n/a
2 TRCN0000108628 CCAAAGAGTTTGCTACGTAAA pLKO.1 362 CDS 100% 10.800 15.120 N Zc3h8 n/a
3 TRCN0000336012 ACGCAGCTCAACCCTCATTAC pLKO_005 498 CDS 100% 10.800 8.640 N Zc3h8 n/a
4 TRCN0000353363 GAGGATGAGTCAAGGCTTTAT pLKO_005 721 CDS 100% 13.200 9.240 N Zc3h8 n/a
5 TRCN0000353296 GTAAGGACTATGACCCATATA pLKO_005 393 CDS 100% 13.200 9.240 N Zc3h8 n/a
6 TRCN0000336011 GTAATTCAGAGTTCCACTTTA pLKO_005 1487 3UTR 100% 13.200 9.240 N Zc3h8 n/a
7 TRCN0000336010 ACACAAGAACTATTGGCTAAA pLKO_005 1013 CDS 100% 10.800 7.560 N Zc3h8 n/a
8 TRCN0000108627 CGTGAACAAATTCCCAAGAAA pLKO.1 311 CDS 100% 5.625 3.938 N Zc3h8 n/a
9 TRCN0000108625 GTCAGTAAATACTTTGCACAA pLKO.1 1455 3UTR 100% 4.050 2.835 N Zc3h8 n/a
10 TRCN0000108626 GCCTGTATTTACATAGTGAAT pLKO.1 909 CDS 100% 4.950 2.970 N Zc3h8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499947.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12827 pDONR223 100% 79.3% 73.6% None (many diffs) n/a
2 ccsbBroad304_12827 pLX_304 0% 79.3% 73.6% V5 (many diffs) n/a
3 TRCN0000474391 TTATCCGCGACACGCCTTGTATCT pLX_317 63.1% 79.3% 73.6% V5 (many diffs) n/a
Download CSV