Transcript: Mouse XM_006499966.1

PREDICTED: Mus musculus sulfide quinone reductase-like (yeast) (Sqrdl), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sqor (59010)
Length:
2346
CDS:
763..2115

Additional Resources:

NCBI RefSeq record:
XM_006499966.1
NBCI Gene record:
Sqor (59010)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499966.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348321 GGACGTCTCTGTCAACTATAA pLKO_005 1521 CDS 100% 13.200 18.480 N Sqor n/a
2 TRCN0000042374 CGCATGTGATTCCTTATGAAA pLKO.1 1613 CDS 100% 5.625 7.875 N Sqor n/a
3 TRCN0000334468 CGCATGTGATTCCTTATGAAA pLKO_005 1613 CDS 100% 5.625 7.875 N Sqor n/a
4 TRCN0000042375 GCGAATTACTATGTACCTAAT pLKO.1 1992 CDS 100% 10.800 8.640 N Sqor n/a
5 TRCN0000042376 GCTGGACTATGAGAAGATTAA pLKO.1 1206 CDS 100% 13.200 9.240 N Sqor n/a
6 TRCN0000334467 GCTGGACTATGAGAAGATTAA pLKO_005 1206 CDS 100% 13.200 9.240 N Sqor n/a
7 TRCN0000042373 GATTGACATGACAGATACAAA pLKO.1 2172 3UTR 100% 5.625 3.938 N Sqor n/a
8 TRCN0000334549 GATTGACATGACAGATACAAA pLKO_005 2172 3UTR 100% 5.625 3.938 N Sqor n/a
9 TRCN0000042377 GCAGCATAAGAAATACCCGAA pLKO.1 1731 CDS 100% 2.160 1.512 N Sqor n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499966.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08775 pDONR223 100% 83.1% 86.8% None (many diffs) n/a
2 ccsbBroad304_08775 pLX_304 0% 83.1% 86.8% V5 (many diffs) n/a
3 TRCN0000478176 TGATTCCTATGGTCTCCAGTCTAC pLX_317 18.6% 83.1% 86.8% V5 (many diffs) n/a
Download CSV