Transcript: Mouse XM_006500172.3

PREDICTED: Mus musculus cyclic nucleotide binding domain containing 2 (Cnbd2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cnbd2 (70873)
Length:
4053
CDS:
132..1292

Additional Resources:

NCBI RefSeq record:
XM_006500172.3
NBCI Gene record:
Cnbd2 (70873)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500172.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 2370 3UTR 100% 4.950 2.475 Y Gad2 n/a
2 TRCN0000075853 GCCTGGTCTATAGAGTGAGTT pLKO.1 4028 3UTR 100% 4.950 2.475 Y Oasl2 n/a
3 TRCN0000194517 GCCTGGTCTATAGAGTGAGTT pLKO.1 4028 3UTR 100% 4.950 2.475 Y Fbxo22 n/a
4 TRCN0000317452 GCCTGGTCTATAGAGTGAGTT pLKO_005 4028 3UTR 100% 4.950 2.475 Y Oasl2 n/a
5 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 2311 3UTR 100% 4.050 2.025 Y Mtif2 n/a
6 TRCN0000088533 CGGGAGGCAGAGGCAGGCAAT pLKO.1 3730 3UTR 100% 0.000 0.000 Y Trrap n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500172.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.