Transcript: Mouse XM_006500270.3

PREDICTED: Mus musculus Ras and Rab interactor 2 (Rin2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rin2 (74030)
Length:
4716
CDS:
312..3023

Additional Resources:

NCBI RefSeq record:
XM_006500270.3
NBCI Gene record:
Rin2 (74030)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500270.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366133 GCAGATTTATTCCGGCTTATT pLKO_005 807 CDS 100% 13.200 18.480 N Rin2 n/a
2 TRCN0000374623 CCATGTGTCCAGCACCGATAT pLKO_005 1976 CDS 100% 10.800 15.120 N Rin2 n/a
3 TRCN0000077540 CCTCTCAAAGAGTTTACTATA pLKO.1 738 CDS 100% 13.200 10.560 N Rin2 n/a
4 TRCN0000374622 GCTTGAACTGGACACGGAAAT pLKO_005 2471 CDS 100% 10.800 8.640 N Rin2 n/a
5 TRCN0000077539 CCGGGACAAATGCACCTATTT pLKO.1 1904 CDS 100% 13.200 9.240 N Rin2 n/a
6 TRCN0000366204 GCACGGAGAAGGAGGCTATTA pLKO_005 2528 CDS 100% 13.200 9.240 N Rin2 n/a
7 TRCN0000077538 GCTGAGAATTAGAAGAGAAAT pLKO.1 3917 3UTR 100% 13.200 9.240 N Rin2 n/a
8 TRCN0000366134 TGCAGACCATCCGGCAGTTTA pLKO_005 1999 CDS 100% 13.200 9.240 N Rin2 n/a
9 TRCN0000374559 GGGCATCCTTTAGATACATTG pLKO_005 3173 3UTR 100% 10.800 7.560 N Rin2 n/a
10 TRCN0000077542 GCCTTATAAATGGAGTGCATT pLKO.1 1042 CDS 100% 4.950 3.465 N Rin2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500270.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12040 pDONR223 100% 45.2% 47.7% None (many diffs) n/a
2 ccsbBroad304_12040 pLX_304 0% 45.2% 47.7% V5 (many diffs) n/a
3 TRCN0000475994 TTCTACCCCCATTGAACAAACTGT pLX_317 23% 45.2% 47.7% V5 (many diffs) n/a
Download CSV