Construct: ORF TRCN0000475994
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005876.1_s317c1
- Derived from:
- ccsbBroadEn_12040
- DNA Barcode:
- TTCTACCCCCATTGAACAAACTGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RIN2 (54453)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475994
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54453 | RIN2 | Ras and Rab interactor 2 | XM_005260733.2 | 57.5% | 47.8% | (many diffs) |
| 2 | human | 54453 | RIN2 | Ras and Rab interactor 2 | NM_018993.3 | 51.5% | 51.3% | 464_1762del;1818C>T;2467G>A |
| 3 | human | 54453 | RIN2 | Ras and Rab interactor 2 | XM_005260731.2 | 51.5% | 51.3% | 464_1762del;1818C>T;2467G>A |
| 4 | human | 54453 | RIN2 | Ras and Rab interactor 2 | XM_006723574.4 | 51.5% | 51.3% | 464_1762del;1818C>T;2467G>A |
| 5 | human | 54453 | RIN2 | Ras and Rab interactor 2 | XM_006723575.4 | 51.5% | 51.3% | 464_1762del;1818C>T;2467G>A |
| 6 | human | 54453 | RIN2 | Ras and Rab interactor 2 | XM_006723577.2 | 51.5% | 51.3% | 464_1762del;1818C>T;2467G>A |
| 7 | human | 54453 | RIN2 | Ras and Rab interactor 2 | XM_011529257.2 | 51.5% | 51.3% | 464_1762del;1818C>T;2467G>A |
| 8 | human | 54453 | RIN2 | Ras and Rab interactor 2 | XM_011529258.2 | 51.5% | 51.3% | 464_1762del;1818C>T;2467G>A |
| 9 | human | 54453 | RIN2 | Ras and Rab interactor 2 | XM_017027890.1 | 51.5% | 51.3% | 464_1762del;1818C>T;2467G>A |
| 10 | human | 54453 | RIN2 | Ras and Rab interactor 2 | XM_024451911.1 | 51.5% | 51.3% | 464_1762del;1818C>T;2467G>A |
| 11 | human | 54453 | RIN2 | Ras and Rab interactor 2 | XM_024451912.1 | 51.5% | 51.3% | 464_1762del;1818C>T;2467G>A |
| 12 | human | 54453 | RIN2 | Ras and Rab interactor 2 | XM_024451913.1 | 51.5% | 51.3% | 464_1762del;1818C>T;2467G>A |
| 13 | human | 54453 | RIN2 | Ras and Rab interactor 2 | NM_001242581.1 | 48.8% | 48.7% | (many diffs) |
| 14 | human | 54453 | RIN2 | Ras and Rab interactor 2 | XM_017027887.1 | 48.8% | 48.7% | (many diffs) |
| 15 | human | 54453 | RIN2 | Ras and Rab interactor 2 | XM_017027888.1 | 48.8% | 48.7% | (many diffs) |
| 16 | human | 54453 | RIN2 | Ras and Rab interactor 2 | XM_017027889.1 | 48.1% | 47.7% | (many diffs) |
| 17 | human | 54453 | RIN2 | Ras and Rab interactor 2 | XM_011529255.2 | 47.9% | 47.8% | (many diffs) |
| 18 | human | 54453 | RIN2 | Ras and Rab interactor 2 | XM_017027891.1 | 45.8% | 45.5% | (many diffs) |
| 19 | human | 54453 | RIN2 | Ras and Rab interactor 2 | XM_011529259.2 | 45.6% | 45.4% | (many diffs) |
| 20 | human | 54453 | RIN2 | Ras and Rab interactor 2 | XM_017027892.1 | 45.6% | 45.4% | (many diffs) |
| 21 | mouse | 74030 | Rin2 | Ras and Rab interactor 2 | XM_006500269.1 | 45.2% | 47.7% | (many diffs) |
| 22 | mouse | 74030 | Rin2 | Ras and Rab interactor 2 | XM_006500270.3 | 45.2% | 47.7% | (many diffs) |
| 23 | mouse | 74030 | Rin2 | Ras and Rab interactor 2 | XM_006500271.3 | 45.2% | 47.7% | (many diffs) |
| 24 | mouse | 74030 | Rin2 | Ras and Rab interactor 2 | NM_028724.4 | 40.2% | 43% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1455
- ORF length:
- 1386
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gacagcttgg accatgggcg cccgcggtct ggacaagcga ggaagtttct 121 ttaagctcat tgacacaatt gcctcggaga tcggagaact gaaacaggag atggtgcgga 181 cagatgtcaa cctggaaaat ggcctggaac ccgctgaaac ccacagcatg gtaagacaca 241 aggatggtgg ctattccgag gaagaggacg tgaagacctg tgcccgggac tcaggctatg 301 acagcctctc caacaggctc agcatcttgg accggctcct ccacacccac cccatatggc 361 tgcagctgag tctgagtgag gaggaggcag cagaggtcct gcaggcccag cctccgggga 421 tcttcctggt tcataaatct accaagatgc agaagaaagt cctctccctc cgcctgccct 481 gtgaatttgg ggccccactc aaggaatttg ccataaagga aagcacatac aatgtggtgc 541 tggaaaaagc catgcacaag tgcatcttga agcccctcaa ggggcatgtg gaggccatgc 601 tgaaggactt tcacatggcc gatggctcat ggaagcaact caaggagaac ctgcagcttg 661 tgcggcagag gaatccgcag gagctggggg tcttcgcccc gacccctgat tttgtggatg 721 tggagaaaat caaagtcaag ttcatgacca tgcagaagat gtattcgccg gaaaagaagg 781 tcatgctgct gctgcgggtc tgcaagctca tttacacggt catggagaac aactcaggga 841 ggatgtatgg cgctgatgac ttcttgccag tcctgaccta tgtcatagcc cagtgtgaca 901 tgcttgaatt ggacactgaa atcgagtaca tgatggagct cctagaccca tcgctgttac 961 atggagaagg aggctattac ttgacaagcg catatggagc actttctctg ataaagaatt 1021 tccaagaaga acaagcagcg cgactgctca gctcagaaac cagagacacc ctgaggcagt 1081 ggcacaaacg gagaaccacc aaccggacca tcccctctgt ggacgacttc cagaattacc 1141 TCCGAGTTGC ATTTCAGGAG GTCAACAGTG GTTGCACAGG AAAGACCCTC CTTGTGAGAC 1201 CTTACATCAC CACTGAGGAT GTGTGTCAGA TCTGCACTGA GAAGTTCAAG GTGGGGGACC 1261 CTGAGGAGTA CAGCCTCTTT CTCTTCGTTG ACGAGACATG GCAGCAGCTG GCAGAGGACA 1321 CTTACCCTCA AAAAATCAAG GCGGAGCTGC ACAGCCGACC ACAGCCCCAC ATCTTCCACT 1381 TTGTCTACAA ACGCATCAAG AACGATCCTT ATGGCATCAT TTTCCAGAAC GGGGAAGAAG 1441 ACCTCACCAC CTCCTTGCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1501 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1561 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA TTCTACCCCC ATTGAACAAA 1621 CTGTACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt