Transcript: Mouse XM_006500305.3

PREDICTED: Mus musculus GDNF-inducible zinc finger protein 1 (Gzf1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gzf1 (74533)
Length:
4113
CDS:
92..2212

Additional Resources:

NCBI RefSeq record:
XM_006500305.3
NBCI Gene record:
Gzf1 (74533)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500305.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000449779 GTACATGTCAATCACACTAAT pLKO_005 2460 3UTR 100% 13.200 18.480 N Gzf1 n/a
2 TRCN0000095182 CCTTGTAGATTCCTCCGACTA pLKO.1 619 CDS 100% 4.050 5.670 N Gzf1 n/a
3 TRCN0000018956 CCACATGCTGATTTATCATAA pLKO.1 1510 CDS 100% 13.200 9.240 N GZF1 n/a
4 TRCN0000095183 GCATACCTCAATACATGATAA pLKO.1 1861 CDS 100% 13.200 9.240 N Gzf1 n/a
5 TRCN0000095179 GCCTGGCAAATCTTGACTATT pLKO.1 3031 3UTR 100% 13.200 9.240 N Gzf1 n/a
6 TRCN0000435052 TTGCTTCTAAGGAGTACTTAA pLKO_005 1584 CDS 100% 13.200 9.240 N GZF1 n/a
7 TRCN0000443560 CAATTCCCTGTACCAGCATAT pLKO_005 1678 CDS 100% 10.800 7.560 N Gzf1 n/a
8 TRCN0000424384 GATGAATGTGGTGCAAGATTC pLKO_005 1481 CDS 100% 10.800 7.560 N GZF1 n/a
9 TRCN0000426820 GGAAGTCTTTCCTTGTCATTG pLKO_005 1893 CDS 100% 10.800 7.560 N GZF1 n/a
10 TRCN0000095181 GCTGTTGACTTTGCTTCGTTT pLKO.1 341 CDS 100% 4.950 3.465 N Gzf1 n/a
11 TRCN0000095180 CCAAGAATGATGAAGGGCATA pLKO.1 1926 CDS 100% 4.050 2.835 N Gzf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500305.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.