Transcript: Mouse XM_006500320.1

PREDICTED: Mus musculus tubulin tyrosine ligase-like family, member 9 (Ttll9), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ttll9 (74711)
Length:
1854
CDS:
391..1494

Additional Resources:

NCBI RefSeq record:
XM_006500320.1
NBCI Gene record:
Ttll9 (74711)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500320.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098557 CCACTATGTTCACCTCACCAA pLKO.1 918 CDS 100% 2.640 3.696 N Ttll9 n/a
2 TRCN0000098555 GCAGAGAACCTTAATCCGCTT pLKO.1 116 5UTR 100% 2.160 3.024 N Ttll9 n/a
3 TRCN0000098556 CACTATGTTCACCTCACCAAT pLKO.1 919 CDS 100% 4.950 3.465 N Ttll9 n/a
4 TRCN0000098559 CCATGGAGTGTCGAAAGGAAA pLKO.1 86 5UTR 100% 4.950 3.465 N Ttll9 n/a
5 TRCN0000098558 GAGAACCTTAATCCGCTTCAA pLKO.1 119 5UTR 100% 4.950 3.465 N Ttll9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500320.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13339 pDONR223 100% 34.8% 32.1% None (many diffs) n/a
2 ccsbBroad304_13339 pLX_304 0% 34.8% 32.1% V5 (many diffs) n/a
3 TRCN0000472304 ATGATCTGCCCAAGATAGAGCTCG pLX_317 70.4% 34.8% 32.1% V5 (many diffs) n/a
Download CSV