Transcript: Mouse XM_006500344.3

PREDICTED: Mus musculus cytoskeleton associated protein 5 (Ckap5), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ckap5 (75786)
Length:
6681
CDS:
142..6240

Additional Resources:

NCBI RefSeq record:
XM_006500344.3
NBCI Gene record:
Ckap5 (75786)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500344.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091589 CCACCTTACAATGATTGATAA pLKO.1 5472 CDS 100% 13.200 18.480 N Ckap5 n/a
2 TRCN0000318258 CCACCTTACAATGATTGATAA pLKO_005 5472 CDS 100% 13.200 18.480 N Ckap5 n/a
3 TRCN0000091591 CGACTGAATGATTCAAACAAA pLKO.1 2863 CDS 100% 5.625 4.500 N Ckap5 n/a
4 TRCN0000318330 CGACTGAATGATTCAAACAAA pLKO_005 2863 CDS 100% 5.625 4.500 N Ckap5 n/a
5 TRCN0000091590 GCAGATTTAGTGAAAGCATTA pLKO.1 1093 CDS 100% 10.800 7.560 N Ckap5 n/a
6 TRCN0000318329 GCAGATTTAGTGAAAGCATTA pLKO_005 1093 CDS 100% 10.800 7.560 N Ckap5 n/a
7 TRCN0000091592 GCACACAGAATATAAACTCTA pLKO.1 4463 CDS 100% 4.950 3.465 N Ckap5 n/a
8 TRCN0000318257 GCACACAGAATATAAACTCTA pLKO_005 4463 CDS 100% 4.950 3.465 N Ckap5 n/a
9 TRCN0000091588 GCAGCTTTAGTTACTGATCTA pLKO.1 6263 3UTR 100% 4.950 3.465 N Ckap5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500344.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11416 pDONR223 100% 42.5% 44.7% None (many diffs) n/a
2 TRCN0000473345 ATCGGGTATTTAAACGTAAGCCGA pLX_317 17% 42.5% 44.7% V5 (many diffs) n/a
Download CSV