Transcript: Mouse XM_006500553.3

PREDICTED: Mus musculus collagen, type IX, alpha 3 (Col9a3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Col9a3 (12841)
Length:
2626
CDS:
159..2093

Additional Resources:

NCBI RefSeq record:
XM_006500553.3
NBCI Gene record:
Col9a3 (12841)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500553.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348124 CTATGATAGACTACCAATAAA pLKO_005 2435 3UTR 100% 15.000 12.000 N Col9a3 n/a
2 TRCN0000348193 GGTATGATCAGTGAGCAAATT pLKO_005 1629 CDS 100% 13.200 10.560 N Col9a3 n/a
3 TRCN0000091630 CAGTGAGCAAATTGCACAGTT pLKO.1 1637 CDS 100% 4.950 3.465 N Col9a3 n/a
4 TRCN0000091628 GCTCCATATTTCCTACTGAAA pLKO.1 2117 3UTR 100% 4.950 3.465 N Col9a3 n/a
5 TRCN0000091629 CCACGAGGATTAAGAGGACTT pLKO.1 726 CDS 100% 4.050 2.835 N Col9a3 n/a
6 TRCN0000091632 CCCGGCAAGGATGGCATTGAT pLKO.1 273 CDS 100% 1.875 1.313 N Col9a3 n/a
7 TRCN0000334119 CCCGGCAAGGATGGCATTGAT pLKO_005 273 CDS 100% 1.875 1.313 N Col9a3 n/a
8 TRCN0000091631 GTACCTGGCATCAGCAAAGAT pLKO.1 1914 CDS 100% 0.000 0.000 N Col9a3 n/a
9 TRCN0000334120 GTACCTGGCATCAGCAAAGAT pLKO_005 1914 CDS 100% 0.000 0.000 N Col9a3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500553.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14592 pDONR223 58.6% 78.7% 85.8% None (many diffs) n/a
2 ccsbBroad304_14592 pLX_304 0% 78.7% 85.8% V5 (many diffs) n/a
3 TRCN0000471031 CTCGCCGATCGATCGTCTTCTGCA pLX_317 20.2% 78.7% 85.8% V5 (many diffs) n/a
Download CSV