Transcript: Mouse XM_006500647.3

PREDICTED: Mus musculus zinc finger protein 512B (Zfp512b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp512b (269401)
Length:
6112
CDS:
784..3393

Additional Resources:

NCBI RefSeq record:
XM_006500647.3
NBCI Gene record:
Zfp512b (269401)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500647.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238521 AGTTGCAGGAAGCACTCAAAT pLKO_005 2318 CDS 100% 13.200 9.240 N Zfp512b n/a
2 TRCN0000238520 CTATGCTAGGTGGGCCTATAA pLKO_005 4260 3UTR 100% 13.200 9.240 N Zfp512b n/a
3 TRCN0000238522 AGCTGGAGAAGCACCGGATAT pLKO_005 1247 CDS 100% 10.800 7.560 N Zfp512b n/a
4 TRCN0000238519 ATGGGCTCAAGTACCACTATC pLKO_005 1145 CDS 100% 10.800 7.560 N Zfp512b n/a
5 TRCN0000238518 TGTGAACTGTCCCAATGATTG pLKO_005 2961 CDS 100% 10.800 7.560 N Zfp512b n/a
6 TRCN0000130566 CCAGTCTTGTTGCTGTGACAA pLKO.1 4688 3UTR 100% 4.950 3.465 N ZNF512B n/a
7 TRCN0000127528 CGCACAAAGCACAGAAGGAAA pLKO.1 1963 CDS 100% 4.950 3.465 N ZNF512B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500647.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08733 pDONR223 100% 83.3% 85.8% None (many diffs) n/a
2 ccsbBroad304_08733 pLX_304 0% 83.3% 85.8% V5 (many diffs) n/a
3 TRCN0000475732 ATACGGCGTCCGCCCCGCTACCTT pLX_317 12.9% 83.3% 85.8% V5 (many diffs) n/a
4 ccsbBroadEn_08732 pDONR223 100% 83.2% 85.8% None (many diffs) n/a
5 ccsbBroad304_08732 pLX_304 0% 83.2% 85.8% V5 (many diffs) n/a
6 TRCN0000470092 GCTGGTGTTTCCAAGGCATACGTT pLX_317 18.5% 83.2% 85.8% V5 (many diffs) n/a
Download CSV