Transcript: Mouse XM_006500706.3

PREDICTED: Mus musculus uridine-cytidine kinase 1-like 1 (Uckl1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Uckl1 (68556)
Length:
2220
CDS:
460..2061

Additional Resources:

NCBI RefSeq record:
XM_006500706.3
NBCI Gene record:
Uckl1 (68556)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500706.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024875 GATCGCTACTTTGGGACAGAT pLKO.1 1993 CDS 100% 4.950 6.930 N Uckl1 n/a
2 TRCN0000037576 GCAGTACAACAAGTTTGTCAA pLKO.1 1173 CDS 100% 4.950 6.930 N UCKL1 n/a
3 TRCN0000322261 TCCTGGACATGAAGATCTTTG pLKO_005 1067 CDS 100% 10.800 7.560 N Uckl1 n/a
4 TRCN0000024874 GCCTGTAACAATTTCAACTTT pLKO.1 853 CDS 100% 5.625 3.938 N Uckl1 n/a
5 TRCN0000322258 GCCTGTAACAATTTCAACTTT pLKO_005 853 CDS 100% 5.625 3.938 N Uckl1 n/a
6 TRCN0000024877 CAGTACAACAAGTTTGTCAAA pLKO.1 1174 CDS 100% 4.950 3.465 N Uckl1 n/a
7 TRCN0000322195 CAGTACAACAAGTTTGTCAAA pLKO_005 1174 CDS 100% 4.950 3.465 N Uckl1 n/a
8 TRCN0000024876 CGGGACATTGAGGGTGTCATT pLKO.1 1150 CDS 100% 4.950 3.465 N Uckl1 n/a
9 TRCN0000322259 CGGGACATTGAGGGTGTCATT pLKO_005 1150 CDS 100% 4.950 3.465 N Uckl1 n/a
10 TRCN0000024878 GCCTTTGCTATTGGCTTAGGA pLKO.1 703 CDS 100% 3.000 2.100 N Uckl1 n/a
11 TRCN0000322257 GCCTTTGCTATTGGCTTAGGA pLKO_005 703 CDS 100% 3.000 2.100 N Uckl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500706.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489164 TCTGGCGGTCCCACGAATTCTCCA pLX_317 18.4% 82.5% 90.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV