Transcript: Mouse XM_006500871.3

PREDICTED: Mus musculus adenosine monophosphate deaminase 2 (Ampd2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ampd2 (109674)
Length:
3382
CDS:
127..2529

Additional Resources:

NCBI RefSeq record:
XM_006500871.3
NBCI Gene record:
Ampd2 (109674)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500871.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119809 GCGGACAGGAATACCTTTCAT pLKO.1 1327 CDS 100% 5.625 4.500 N Ampd2 n/a
2 TRCN0000326236 GCGGACAGGAATACCTTTCAT pLKO_005 1327 CDS 100% 5.625 4.500 N Ampd2 n/a
3 TRCN0000119810 CGCTAACATGGCTATGTTGAA pLKO.1 1884 CDS 100% 0.495 0.396 N Ampd2 n/a
4 TRCN0000326300 CGCTAACATGGCTATGTTGAA pLKO_005 1884 CDS 100% 0.495 0.396 N Ampd2 n/a
5 TRCN0000051796 CCAAGGCCAAATATCCCTTTA pLKO.1 214 CDS 100% 10.800 7.560 N AMPD2 n/a
6 TRCN0000119807 CCCATCTCAGAATTGTCAGAA pLKO.1 2769 3UTR 100% 4.950 3.465 N Ampd2 n/a
7 TRCN0000326235 CCCATCTCAGAATTGTCAGAA pLKO_005 2769 3UTR 100% 4.950 3.465 N Ampd2 n/a
8 TRCN0000119808 CCTGTACTACACCTTCGCTAA pLKO.1 1869 CDS 100% 4.050 2.835 N Ampd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500871.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00063 pDONR223 100% 86.6% 91.9% None (many diffs) n/a
2 ccsbBroad304_00063 pLX_304 0% 86.6% 91.9% V5 (many diffs) n/a
3 TRCN0000471533 AAATGCGGGGTAGAGTTCTGCGTG pLX_317 16.1% 86.6% 91.9% V5 (many diffs) n/a
Download CSV